Disease: Episodic ataxia type 2 (disorder) ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs786200963
rs786200963 		0.827 0.200 19 13371683 splice region variant C/T snv
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.700 1.000 1 2015 2015
dbSNP: rs786200962
rs786200962 		0.827 0.120 19 13298768 frameshift variant A/- del
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.700 1.000 1 2015 2015
dbSNP: rs1555755909
rs1555755909 		0.925 0.120 19 13298704 frameshift variant GCTCCGCCTTGTCCTCCGGACCCTCC/- delins
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1555756461
rs1555756461 		0.925 0.120 19 13299314 frameshift variant CAC/GT delins
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1555757523
rs1555757523 		0.925 0.120 19 13303832 frameshift variant T/- del
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1555762855
rs1555762855 		0.925 0.120 19 13317146 frameshift variant AACAATAGCAACACACAGCGTG/- delins
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1555762869
rs1555762869 		1.000 0.120 19 13317187 frameshift variant TG/- del
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1555762908
rs1555762908 		0.925 0.120 19 13317228 frameshift variant C/- del
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1568514371
rs1568514371 		1.000 0.120 19 13303803 frameshift variant AG/CTCC delins
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1568528298
rs1568528298 		0.925 0.120 19 13317254 frameshift variant -/T delins
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.700 0
dbSNP: rs587776692
rs587776692 		1.000 0.120 19 13283295 frameshift variant G/- delins
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.700 0
dbSNP: rs587776694
rs587776694 		1.000 0.120 19 13298819 frameshift variant -/C delins
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.700 0
dbSNP: rs587776695
rs587776695 		1.000 0.120 19 13253015 frameshift variant C/- del
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.700 0
dbSNP: rs746790849
rs746790849 		1.000 0.120 19 13286645 frameshift variant G/-;GG delins
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1568457080
rs1568457080 		0.925 0.120 19 13245181 splice donor variant C/A snv
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.700 1.000 5 1999 2016
dbSNP: rs1272886269
rs1272886269 		0.925 0.120 19 13335805 splice donor variant C/T snv 4.2E-06
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1315533129
rs1315533129 		1.000 0.120 19 13285067 splice donor variant C/A;T snv 4.1E-06
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.700 0
dbSNP: rs587776693
rs587776693 		1.000 0.120 19 13275849 splice donor variant C/T snv
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.700 0
dbSNP: rs121908212
rs121908212 		0.732 0.160 19 13303877 missense variant G/A snv
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.800 1.000 22 1996 2017
dbSNP: rs121908227
rs121908227 		1.000 0.120 19 13261495 missense variant A/C snv
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.810 1.000 16 1996 2014
dbSNP: rs121908215
rs121908215 		0.882 0.160 19 13359707 missense variant C/T snv
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.800 1.000 15 1996 2011
dbSNP: rs121908216
rs121908216 		0.882 0.200 19 13235702 missense variant C/T snv
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.800 1.000 15 1996 2011
dbSNP: rs121908226
rs121908226 		0.925 0.120 19 13231847 missense variant C/T snv
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.810 1.000 15 1996 2011
dbSNP: rs121908228
rs121908228 		1.000 0.120 19 13365344 missense variant G/A snv
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.800 1.000 15 1996 2011
dbSNP: rs121908229
rs121908229 		1.000 0.120 19 13234966 missense variant T/A snv
CUI: C1720416
Disease: Episodic ataxia type 2 (disorder)
Episodic ataxia type 2 (disorder) 		Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.710 1.000 15 1996 2011